Protocol for SLST for C. acnes and List of SLST alleles (updated October 2017)

Original primer set
Forward primer
5'-CAGCGGCGCTGCTAAGAACTT-3'
Reverse primer
5'-CCGGCTGGCAAATGAGGCAT-3'

New primer set (not validated in a publication, but may provide better readings from Sanger sequencing for some strains since the distance from the primers to the needed sequence is a little longer.)
Forward primer
5’-CGCCATCAAGGCACCAACAA-3’
Reverse primer
5’-ATATCGGCCCGTATTTGGGC-3’

PCR reaction mixture
PCR reactions are carried out in a 25 µl volume containing:
10 µl 5’-PRIME Hotmastermix (5 PRIME, Hamburg, Germany)
3 µl of each primer (10 µM)
4 µl of PCR grade H2O
5 µl of diluted DNA

PCR cycling conditions
Start with an initial denaturation at 96°C for 40 seconds,
followed by 35 cycles at:
[94°C for 35 seconds]
[55°C for 40 seconds]
[72°C for 40 seconds]
Finally extend at 72°C for 7 minutes.

List of SLST alleles (updated October 2017)
>A1
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A10
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCTACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A11
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGCACCAGGAAGCCCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A12
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATATTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A13
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTGGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A14
GTTGCACACCAGGGGGTCAACTTGGCGTTTTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A15
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGTACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A16
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATCCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A17
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCGGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A18
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGCCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A19
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCGACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A2
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A20
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTTTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A21
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACAATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A22
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTGGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A23
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCCAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A24
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGTCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A25
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATGGGCATAG
>A26
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTTCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A27
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCCGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A28
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACAAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A29
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATTCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A3
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATGGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAATAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A30
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATGCAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A31
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATACGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A32
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATTGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A33
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACACCAGCATAG
>A34
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCATGCCCGCCTACATACCCATTACATCAGCATAG
>A35
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCAGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A4
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATGGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A5
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A6
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAT
>A7
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGCCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A8
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGCCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>A9
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGCCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCTCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCATGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>B1
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>C1
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>C2
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCATGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>C3
GTTGCACACCAGGGGGTCAACTTGGCGTCCTTAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>C4
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCTGCATAG
>C5
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCGCAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>D1
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCACGAAGACCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTTGAGGATACAGTCGTCCATCACGCCCACCTACATACCCATTACATCAGCATAG
>D2
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAACGCCGCGATATATGTTCCGCCCTGTCATCACGAAGACCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTTGAGGATACAGTCGTCCATCACGCCCACCTACATACCCATTACATCAGCATAG
>D3
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCTTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCACGAAGACCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTTGAGGATACAGTCGTCCATCACGCCCACCTACATACCCATTACATCAGCATAG
>D4
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCACGAAGACCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTTGAGGATACAGTCGTCCATCACGCCCACCTACATACCCATCACATCAGCATAG
>D5
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCGCCCTGCCATCACGAAGACCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTTGAGGATACAGTCGTCCATCACGCCCACCTACATACCCATTACATCAGCATAG
>E1
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTTAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACCTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGAATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>E2
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTTAAACTAACAGTTCCATGTCGGGAAACAGCACCAGAAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACCTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>E3
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTTAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACCTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>E4
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTTAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACCTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGAAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>E5
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTTAAACTAACAGTTTCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACCTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>E6
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTTAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATTCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACCTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>E7
GTTGCACACCAGAGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTTAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACCTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>E8
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTTAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCGCCTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>E9
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATAGATTTAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACCTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F1
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTATATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F10
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACACCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F11
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTATATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATACCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F12
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGCGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F13
GTCGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F14
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATATATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F2
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTATATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACACCAGCATAG
>F3
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTATATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTAAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F4
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F5
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTAGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F6
GTTACACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F7
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTATATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATTCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCAAGCCCGCCTACATACCCATTACATCAGCATAG
>F8
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGAAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>F9
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGATGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>G1
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGCCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGGGTGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAACGCCACCACAATCGATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>H1
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATATCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>H2
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATATCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTCATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>H3
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATATCGTCCACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>H4
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATATCGTCTACCCTTGTCAGACCCGGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>H5
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCCATATCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>H6
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAGGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATATCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>H7
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATATCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATATATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>H8
GTTGCACACCAGGGGGTCAACTTGGCGTCCTCAGTTCAAAATTGATTCAAACTAACAGTTCCATGTCGGGAAACAGCACCAGGAAGCTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATGTACATTTCTAAGCTATATCGTCTACCCTTGTCAGACCCAGGACGATGGATGTCACATCCCCTTTCTAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGTTCCACCCTGTCATCACGAAGGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAACAACTCGATCCACCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATTTATATTCGAGGATACAGTCGTCCATCACGCCCGCCTACATACCCATTACATCAGCATAG
>K1
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K10
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCATCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K11
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATGTCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K12
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATACTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K13
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTTGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K14
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCATGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K15
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGCGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K16
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTATCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K17
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATTCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K18
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCTTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K19
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCACTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K2
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K20
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTGCCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K21
GTTGCACACCAGGGGGTCAACTTGATGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K22
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCATGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K23
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTAACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGAAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K24
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K25
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K3
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K4
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTAACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K5
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCTCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K6
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTATTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K7
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGAAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGTTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K8
ATTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>K9
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGGTTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGTGACATATCGTCTTTCATTGCGAGAAACATCTTACTTATACACATTTCTAAGCTATATTGTCTACCCCTGTCAGACCCAGGACGATGGGTGTCATATCCCCTTTCCAGTCAACCTAAGAAGGGAGGAAATGCCGCGATATATGTTCCGCCCTGTCATCATGAATGCCACCACAATCTATCCCGGAACAGCCGTACTTCACCCACCATGCCCCGATGCTGGATTCCTATGGTCGCCCTTATTAGAGCAAGCGGTGCCAGCAGCAGAATATTTCACCTCAGCAACTCGATCCGCTCCTGCCCATTACATGGGTAACATATCCATGGAGGTACGATGTATGCATCGAGGATGCAGTCGTCTACTATGCCCGCCTACATACCCATTCCATCAGCATAG
>L1
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTATCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATGCGCATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>L10
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATGCGCATTTCTAAGCTATAGCGTCTACCTTTGTCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGCAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>L2
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTATCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATGCGCATTTCTAAGCTATAGCGTCTACCCTTGCCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>L3
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTATCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATGCGCATTTCTAAGCTATATCGTCTACCCTTGCCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>L4
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATGCGCATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCTGCCCATTACATGGTTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>L5
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATGCGCATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>L6
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTATCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATGCGCATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCCGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>L7
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATGCGCATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGCGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>L8
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCAGTTCAAAATTGATTCAAACTAACGGTTCCGTGTCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCAAGAAAAATCTTACTTATGCGCATTTCTAAGCTATAGCGTCTACCCTTGTCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACCCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGCGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>L9
GTTGCACACCAGGGGGTCAACTTGGTGTCCTCGGTTCAAAATTGATTCAAACTAACGGTTCCGTATCGGGAAACAGCACCAGAAAACTCGGGACATATCGTCTTTCATTGCGAGAAAAATCTTACTTATGCGCATTTCTAAGCTATAGCGTCTACCCTTGCCAGACCCAGGACGATGAGTGTCACATCCCCTTTCCAGTCAACCTAAGAGAGGAGGAAATGCCGCGATATATGCTCCGCCCTGTCATCACGAAAGCCACCACAATCTATCCCAGAACAGCCGGCACTTCACTCACGATGCCCCGATGCTGGATTCCTATTGTCGCCCTTATTAGGGCAAGCGGTGCCAGTAGCAGAATATGTCACCTCAGCAACTCGATCCGCCCCTGCCCATTACATGGGTAACATATCCATGGAGGTTCGATGTATACTCGAGGATACAGTCGCCCATCACGCCAGCCTACATACCCATTACATCAGCATAG
>M1
GTTGCACACCAGGGGGTCAACTTGGTGTCCCCAGTTCAAATCTGATTCAAAGCTGACGGTTTCGCGTCGGGAAACGGCGCCAGAAAACCCGTGACATATCATCTTCCATTGCGAGAGACATCAATTGGCACTTATGCACATTTCTATGACATGACATCTACCCTTGTCAGGGTAAGGACGATGGGTGTCACATCCCCTTTCTATCCAACCCAAGAAAGGAGAAAATGCCGCGAGACATATCCCATCCTGTCACCAAGAAGGCCACCATAATTTACTCAGGAACGGTCGATAATTCTCTCACCATACCCCGATACAGAATCCTCGTTGTTGTCCTTATTGGGGCAAGCAATATCAACAGAAGAATACCTCGCCTCAGCATGTCGACCCACCCCTGCCCATTACATGCGTGACATATCCACAAGGGTACGATGCATGCCCGGGGATGCAGTCGCATACCACACCCAACCAAATACCCATTCAATCAGCATAG
>M2
GTTGCACACCAGGGGGTCAACTTGGTGTCCCCAGTTCAAATCTGATTCAAAGCTGACGGTTTCGCGTCGGGAAACGGCGCCAGAAAACCCGTGACATATCATCTTCCATTGCGAGAGACATCAATGGCACTTATGCACATTTCTATGACATGACATCTACCCTTGTCAGGGTAAGGACGATGGGTGTCACATCCCCTTTCTATCCAACCCAAGAAAGGAGAAAATGCCGCGAGACATATCCCATCCTGTCACCAAGAAGGCCACCATAATTTACTCAGGAACGGTCGATAATTCTCTCACCATACCCCGATACAGAATCCTCGTTGTTGTCCTTATTGGGGCAAGCAATATCAACAGAAGAATACCTCGCCTCAGCATGTCGACCCACCCCTGCCCATTACATGCGTGACATATCCACAAGGGTACGATGCATGCCCGGGGATGCAGTCGCATACCACACCCAACCAAATACCCATTCAATCAGCATAG

Reference
Scholz CFP, Jensen A, Lomholt HB, Brüggemann H, Kilian M (2014) A Novel High-Resolution Single Locus Sequence Typing Scheme for Mixed Populations of Propionibacterium acnes In Vivo. PLoS ONE 9(8): e104199. doi:10.1371/journal.pone.0104199
Go to PLoS ONE